METABLE2 Genes

PROKKA_00002 Bacillus

GenomeBacillus ctg_1:1078-1593
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00002 hypothetical protein
ATGGATTTTATAAATGACATTAGTGAAGAAGCTAAAGTTGCACTAGGCTTAGCAATAGCC
GAAAAAATGTATGCATTCATAGATAAAGAAGATGATGGTTACCACATAGGAGAAAAAGCT
CTAGAAGATTGCTGGAAATGGCTTTCTGGTAAAGAGTTAAGTGCAGATGATTTATGTAAC
TACATAGATAGTGAAGATTATATGGATGTAGCCGAGTTCGCAAATAAAGAAAAAGATGAA
CAAAAACAATATGGCTGGTATTCAGTATTAGATGCGGTTTCTTATACAGCTTATCAAGCG
TATAAACGAGAAAATAAAAAATTTGTTCCGCAAGTGCTAGAGATAATAGATGATGAAACA
TTGAATACACTTTGGGAAAATGCTATAGAATCAAAAATGATTGATATAGCTGAACTGAAA
ACCCTAACGAAGTATCTAATTGATCATTATCCTAGCAAATATCAAGATAACAAGTTATAT
TTAATCAACAAAGAGGATCTCCCATTAGGCGATTAA