METABLE2 Genes

PROKKA_00006 Bacillus

GenomeBacillus ctg_1:4778-5506
ProductCDS Arylesterase precursor
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q07792
Sequence
>PROKKA_00006 Arylesterase precursor
GTGAAGAAATTTGTTTTCCTTTTCATTCTGTTATGTGTTGCTGCTGGGTGCTCAAAACCA
GTGCAGGAAAGCGTGATTGCATTTGGTGACAGTAACACAAGAGGATCGAACTGGGATTTT
CGAGATTATCCCACATCTGAAAAATGGGTGAATCTCATGAAAAACGTCGAGCGTGGCCAA
ATCAAGGTACAGAATGCCGGGATTGGCGGGCAGACAACAGAAGATGCGAAGCTGCGCTTT
GAGCAGGATATTTTAAAACAAAAACCAACTTACGTCCTCATCATGTTCGGTACAAATGAT
GCTGCGATTCTAGACGGGAAACATCCCCGTGTGACCAAAAAACGATTTAAAGAAAACTTA
TCCTACTTCATTTCTGAAAGTAGGAAAGAGGGAATTACCCCGATCCTCATGACGTGCGTG
CCTGTGGTGGAAGGAGGCAAAAAGGGCTTGTATTATTATTCTAGATATAAGTCATCTTAT
TTTGCTGAGAGAGGCGGGGCGAGAGCTTGGCAAAACTCATACAATGACATCACAAGACAA
GTAGCTGAAAAACAGCAAGTGCCGCTTGTCGACAATTGGAAAGCGTTCATCCGAGAAGCG
GGTGAAGATAGTGACAACGCCTTGATTCAGTCTGGCCTCATTGACCCTTCTGGCAATCAT
ATGACACCAAAAGGGGCAAGAATCATTTATAACGAAATCAAAGAGCGTGATGTCATTAAA
CATTTTTAA