METABLE2 Genes

PROKKA_00007 Bacillus

GenomeBacillus ctg_1:5585-5734
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00007 hypothetical protein
ATGTGGGGATGTCCTTATCCTTACCCTGCGTGTTCGCCTTATCCAGCTCAAGGAGCAGGA
ATCGGTTACGCTTTTCTTGTTGTGTTCCTTGTCGTCATTTTGGTCGTAGGTGGAGGGTTA
TGGTTTTGGAATGAACAGCCTTGCAAATAA