METABLE2 Genes

PROKKA_00008 Bacillus

GenomeBacillus ctg_1:6365-6895
ProductCDS UMP phosphatase
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK10444
Sequence
>PROKKA_00008 UMP phosphatase
GTGCAAATTGTGCTAAAGAAGTATTTCTTACCGGATGAATTTGTGAAAAGTATTTTCCAC
ATTTCGCCGCAAAAACTAAAAGAACGAAATGTAAAAGGAATTATTACGGATTTAGATAAC
ACACTAGTAGAATGGGATCGTCCAAGTGCGACCCCGCGTTTAATTGAATGGTTTCAAGAG
ATGAAAGATCACGGGATACAGGTGACGATTGTATCGAACAATAATGAAAAAAGGGTCAAG
CTTTTTTCTGAGCCGGTTCATATCCCGTTTATTTATAAAGCGAGAAAACCGATGGGAAGA
GCCTTTAATAAGGCCGTCGCTGATATGCAATTGAAGAAAGAAGATGTGGTTGTCATTGGC
GATCAGCTTATGACAGATGTGCTTGGCGGAAACAGGCATGGCTTTCATACCATTTTGGTT
GTACCTGTTGCGGCATCGGACGGATTTTTCACGAAGTTTAACAGGCAGATTGAACGCAGA
ATTTTAGGAGCCTTAAAGCGTAAGGGCCACATTCAGTGGGAGGAAGAGTAA