METABLE2 Genes

PROKKA_00009 Bacillus

GenomeBacillus ctg_1:6898-7998
ProductCDS GTP-binding protein Der
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK00093
Sequence
>PROKKA_00009 GTP-binding protein Der
ATGGAAAAGGTTGTTTGTATTGGCTGCGGTGTAGCCATTCAGACGGAAGATAAAGATCAA
TTAGGATATGCGCCGGCAGCATCTCTATTGAAAGAAGATGTGATCTGTCAGCGCTGTTTT
AGGTTAAAGAACTACAATGAAATTCAGGATGTATCTTTAACAGAAGACGACTTTTTAAAT
ATTTTACACAGCATTGGCGAGACTGATTCTCTGATCGTCAAGGTCGTTGATATTTTTGAC
TTTAACGGAAGCTGGATTAATGGACTGAGCCGTATTGTTGGTGGTAATCCCATTTTACTT
GTCGGCAACAAGGTAGATATTTTACCGAAATCCGTGAAAAAAGACCGTCTTGTTCAATGG
ATGAAGCGGGAAGCAAAAGAAAATGGGCTCAATCCGATTGATGTGTTTTTAATCAGTGCG
AGCAGAGGACAAGGTGTGCCTGAGGTTATGGAGGCCATTGATCATTACCGTGAGGGCAGA
AATGTCTATGTTGTCGGCTGTACAAATGTTGGGAAATCAACATTTATTAACCGCATTATC
AAAGAGGTGTCTGGAGAAGAGAATGTGATCACCACATCCCAATACCCAGGGACAACACTT
GATGCGATTGAAATCCCGCTTGATGACGGGTCTGCTTTATTCGATACACCGGGGATCATC
AACCGCCATCAAATGGCGCACTATGTCGGCAAAAATGACTTAAAGATTTTAACGCCGAAA
AAAGAATTGAAACCGAGAACGTTCCAGTTAAATGAAGCTCAAACGCTTTACTTTGGCGGA
CTGGCTCGATTTGATTATGTAAAAGGCGGCAGAACATCCTTTGTCTGCTACATGCCAAAT
GAACTCAACATTCATAGAACGAAGATGGAGAATGCAGATGACTTATATGAAAAGCATGCA
GGTGAACTGCTTTCACCGCCATCAAAAGAGGGAATGGAAGATTTCCCGCCGCTCGTTCCG
CACACTTTCACCATCGATCAGCCAAAAATGGACATTGTCTTTTCAGGATTAGGCTGGGTG
ACGGCAAATGATGCTGGGAAACAAATCAAAGTGTATGCGCCAAAAGGCGTGCACGTGTTT
ATGAGACGTTCGTTAATTTAA