METABLE2 Genes

PROKKA_00011 Bacillus

GenomeBacillus ctg_1:8856-9146
ProductCDS RNA-binding protein
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:P71376
Sequence
>PROKKA_00011 RNA-binding protein
ATGTTAAAAGGTAAGCAAAAACGTTTTTTACGTGCGCAAGCACATCATTTATCACCTATT
TTTCAAGTTGGAAAAGGCGGGGTAAATGACAATATGGTCAAGCAAATTTCCGAGGCGCTT
GAAGCAAGAGAACTTTTGAAAGTCAGCGTATTGCAAAACTGCGACGAGGACAAAACAGAG
GTTGCAAAAGCACTTGTAAAAGGTGCAAAAGCTGAACTCGTTCAAACGATCGGAAATGTG
ATTGTCCTTTATAAGGAATCAAAGGAAAATAAACAAATTAAGCTGCCGTAA