METABLE2 Genes

PROKKA_00013 Bacillus

GenomeBacillus ctg_1:9719-10282
ProductCDS putative nicotinate-nucleotide adenylyltransferase
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK07152
Sequence
>PROKKA_00013 putative nicotinate-nucleotide adenylyltransferase
ATGAATCGTGAAGAAGCTTTAAACTGTGTCAAACAGCAGTTAACAGAGCATAGATATACA
CATACAATTGGGGTAATGGAGACGGCCATTTCATTAGCTGAACGTTTTGGTGCAGATGTG
AAAAAAGCAGAGGTCGCGGCTATTTTCCACGATTATGCTAAATTTAGACCGAAAGAAGAA
ATGAAGGGCATCATCCAGCAAGAACAGATGAACCCTCTATTGCTTAAATATTCATCTGAG
CTTTGGCATGCCCCAGTTGGTGCCTATTTGGTCAAAAAAGAAGTTGGAATTGACGACCAA
GATATTTTAACAGCCATTGAATTCCATACATCCGGCAGACCGAACATGACATTGCTTGAA
AAAGTGATTTATGTCGCCGACTATATAGAGCCAGGACGCCATTTTCCTGGTGTGGAGGAA
GTAAGAGAGTTAGCAGAGCAGGATTTGGACCTTGCCTTGATTCAATCTTTAAAAAACACC
GTCAACTTTTTAATGAAAAAGAATCAGCCAGTTTTCCCAGATACACTTGCTACTTATAAC
TCACTTGTGCAAAAGAACAACTAA