METABLE2 Genes

PROKKA_00015 Bacillus

GenomeBacillus ctg_1:10648-11391
ProductCDS Glycine/sarcosine N-methyltransferase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q83WC4
Sequence
>PROKKA_00015 Glycine/sarcosine N-methyltransferase
ATGATTTATCAAGGGTTTGCAGGTGTGTATGATGAGCTCATGACACATGCCCCTTATGAT
GAATGGGTTCAGTGGATACAGCGGTATATCAAGCCAAATAGTGCGATTATCGATGTAGGT
TGTGGAACTGGAGAGATCTCTCTTCGGTTAGCTGCAAAAGGCCACATGGTCACAGGAATT
GACCTAAGTGAAGAGATGCTGGCATTTGCGCAGCAAAAAGCACAGGCTCATAAGCAGTCT
ATTCAATTTTTACATCAAGATATGAGAGAGCTTGAGGGGTTTGAACAAACTTTTCAAGCA
GCGGTTATTTGCTGTGATTCTTTGAATTATCTAAAAAACGAAAATGACGTCAAAAAAACC
TTTAAAAACATGTTTCAGCTTTTAGAGACAGGTGGGGTTTTATTGTTTGATGTTCATACC
CCTTATAAAATGGAAGAGGTATTTCCTGGCTCTACTTATGCCGATCAAGATGAAGAAATC
AGCTACATTTGGGAGAGTGATAAAGGGGATGACCCATATTCGGTTATTCATGATTTAAGC
TTTTTTGTAAAAGACGGAGACGTGTATGAGCGTTATGATGAAACGCACGAACAACGTACA
TTTCCTTTTGAGACATATGCAGCGTTCCTTGAGTCCGCTGGCTTTGAACAGATTGAAGTG
ACCGCTGATTTTACAAATGAAGCACCTCAAGAATGTGCAGAAAGATATTTTATTTCAGCG
AAGAAACCAAAAACCATCGTTTAA