METABLE2 Genes

PROKKA_00019 Bacillus

GenomeBacillus ctg_1:13606-15963
ProductCDS ComEC family competence protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK11539
Sequence
>PROKKA_00019 ComEC family competence protein
ATGAAAAGGCGAATCAATTATTTACTTCCTATGTTTAAGTATTTGCCGTTCGGGGCGATT
TCAGCAGCTGTTGGAATTGCTCTGGCCGCATATCATCTTCATCTGTATTTTCTCCTTTTT
CTTCTTGTATGTCTTCTTTTCAGTCTGCTGAAAAAAACACCCCAGCTCTTTCTAATGGTC
AGTTTGTGTGGAATGATCTATATGCTCATTTTTATGGTGCATCAGTCTTTTGAAACGGAT
CATCCTGTACAAGAAAAAGCATTTTCTGATTCGGTTGTGATTGAAACGATTCCGAAAATA
GATGGCAATCGCTTTTCAGCGACTGTTTCATCAGAGAATCGTCGACTAGCGGCATTTTAT
ACGATTCAAACGGAGCGTGAAAAAGAAGCGCTAAAAGATGTTGGGCCAGGTATGAGCTGT
CATATGACAGGTGAGATGCGGTTGCCTAAACATGCAACCATACCGAATGGCTTTCAATAT
GATCAATTTCTAAAAACAAAAGGCATTGATGCTATTTTCCTAACGCAGTCTATGAAAAGC
TGCACGAAACATGACAGCCCTTCACATTACCTTTCATCTATTAGGCAGAAGGGGTTGAAA
TTTCTAGAAGATCACGTTCCGAAGAGTTCTGTTGGGATTGTGCAGGCACTTATTTTTGGC
GATCGTGATTTAATAGACCCTGATACATTAAGAGATTATCAAATGCTTGGCATCATTCAT
TTATTAGCCATTTCAGGACTTCATGTTCAAACATTGCTCGCTTGTCTATTTTGGTGTCTA
CTCCGCGCTGGCGTGACAAGAGAGACAGCGCGTATTCTTTTATTATCCTTTTTGCCGGTT
TATGCTTGTTTAACAGGTGCTGCACCGTCTGTGTTAAGAGCCTGTCTCATGGCTGGAATT
TATTTAGTCATCACAAGCCTGCCAAAAGAAATGAAACAGCCTTCTGCGGTCGTGTTAAGT
GCAGCGTTCTTGCTTTTATTAGCCATTCAACCACTTTATATATTTGATGTCGGTTTTCAA
CTGTCATTTGTGGTGACCTTATTTATTTTGCTATCCACTAGTATTTTATCAAAAGCAAAA
AGTTCGGTGATGCAGTTATTCCTCATTTCCTTGATTGCACAGCTTGCTTCGCTTCCTGTT
CTTTTATATTATTTTCAGCAATTTTCCTTGCTGAGTGTTCCTTTAAATATGATGTTTGTT
CCTTTTTATACAATGGTTGTCCTGCCCCTGTCCTTATTCTTTTTTCTTTTATCTATCATT
TATCTTCCGCTTGGACAAACACTGTTTCAGCTGCTTGATTGGGTGATCCAGTTTAGTCAT
CAATTGTCAGCACATATGGCTGCTTACGATAGTCTTACTCTCATTTTTATGAAATCGACA
TGGTGGCATGTTCTCCTAGAGGTTTCCTCCATTGTTTTTCTATTCATTGTGATGGAATGT
AAAACTTCTATCAAATCTTATCTTGTGCCTATTTTGATTCTCGTTTGTGTGCTGGCTGTA
CACTATTTCACGCCGAATTTTCTTCAAAAAGGAGAGGTCACAATGTTAGATGTAGGACAA
GGGGACAGTTTGTTTATTCAGCTACCTTATCGAACTGGGCATATATTAGTCGATACAGGA
GGCAGACTTTCTTTTGAAGAAGAGCCATGGAAAAAAAGACGTAAAGTATCTACAATTGGG
GATCAAACGCTTATTCCATTTCTGCATTCTAAAGGCATAGCAAAACTTGATGTCCTCATC
CTTACCCATGCAGATCAAGATCATATGGGAGAAGCGATGCGGTTAATAAAGCGAAATAAA
GTCAAACGCCTTGCAATCCCAAAAGGCTTTGCTCGAAATCCAGAGGATGCGCAGCTTTTA
AAGGAAGCGGCTGATCAAAGGATTCCTGTAGATGAGTTAGAAAGAGGGGATCAGTTGAGA
ATTGGAGGACAAAAATTTGACGTTCTGCATCCTGCACGTGACCAGGTGACGAGTAAAAAT
AATGATTCACTGGTCCTCACCTTTATGCTTGGCGGCAAGCGTTTTATGCTGACTGGGGAT
CTTGAACAAGAAGGGGAACGAGACATCATTCAAGCTTACCCCAAGCTACGAGCGGATGTC
TTGAAGGTTGGACATCACGGGAGTAAAGGATCAACAAGTGAAGAATGGCTTCAGCATTTG
AACCCGTCATATGCACTGATTTCAGCAGGTGAACGAAATCGGTATCACCATCCTCATCAA
GAAGTTTTGAAAAAATTAAATGAGCATCAAACAAAGGTGTATCGTACAGATATCGATGGA
AGTGTGACCTATGAATTTCTTGAAGAGGATGGAACATTTTACGCTCATCCTCCATATGAT
ATCTTACAAAATCAATAA