METABLE2 Genes

PROKKA_00020 Bacillus

GenomeBacillus ctg_1:16003-16137
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00020 hypothetical protein
ATGAATGAATTTGAAAAGAATGTTCAAAGCAAGCGGAATGATGTGACCGACTCAGCTGTT
GGTTTTATCGTCACATTCGGATTTTTCGCCTCAATGTTTATTTTGGCAACAGTGATACAC
CTCGTTGGATCTTAA