METABLE2 Genes

PROKKA_00021 Bacillus

GenomeBacillus ctg_1:16376-17395
ProductCDS DNA polymerase III subunit delta
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK05574
Sequence
>PROKKA_00021 DNA polymerase III subunit delta
ATGGTCTTTGAAGTATGGAACAATTTAAAAAAAGGGGATATCCATCCCGTTTATTGCTTA
TATGGAAAAGAAACGTATTTACTTCAAGAGACAGCTGCAAAATTGAGACAAGCTGTCGTC
GACGAAGAAACAAAGGATTTTAATTACTCTGTCTTCGATATGGAAGAGGTGCCGCTTGAG
CAGGCTGTGACGGACGCAGAAACATTTCCGTTTATGGGAGAGCGGCGTCTCGTTGTGATC
AAGAACCCTTATTTCCTCACTGCAGAAAAGAAAAAAGAAAAGATCGAGCATCAGCTTTCT
GTGTTAGAAGCTTATTTAGAAAAGCCAGCACCCTACACGATTCTCGTGTTATTAGCACCA
TATGAAAAACTGGACGAACGTAAGAAAATCACCAAATTGTTAAAAAAGAAAGCGGCTGTG
GTTGAGGCGAAAGAGTTAAATCCGAAAGAAACAACAGATTTCACCATTACATTAGTGAAA
ACAGAAGGAAAAACAATCTCGGCTGAAGCGGCAGAACAGCTTGTCATGTTATGTGGCGGG
AGCCTGTCCTCACTTTTTCAAGAGGTTCGAAAGCTAAGTACATATATTGGGCAGCGAGAG
GAAATTGAGCTGGCGGATGTCAATCAGCTCGTTGCACGAAGTTTGGAGCAGAATATTTTC
GAACTGATTAACCAAATCGTGAACAGGCGCCGGTCTGAAGCGATGCAAATGTTTTATGAT
CTCCTAAAGCAAAATGAGGAACCCATTAAAATATTGGCACTCATTTCAAATCAATTTCGG
TTGATATTGCAGACAAAGTACTTTGCCCAACAGGGATATGGGCAAAAACAAATTGCGTCA
AACCTGAAAGTCCACCCATTTCGGGTCAAACTCGCGATGGATCAGGCAAGACTGTTTTCA
GAAGAAGAGCTAAAGTACATCGTCAAAGAGCTCTCCACGATTGATTATGAAATGAAAACG
GGTAAAAAGGACAAGCAGCTATTATTAGAATTGTTCCTGCTTCGGTTATTAGGGGCTTGA