METABLE2 Genes

PROKKA_00024 Bacillus

GenomeBacillus ctg_1:19177-20385
ProductCDS Stage II sporulation protein P (SpoIIP)
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF07454.5
Sequence
>PROKKA_00024 Stage II sporulation protein P (SpoIIP)
ATGAAAAAAAGACCTCGCCGTCCTCGACAGTTGGTCATTGCGATTAATGGAACAAAAGTA
GTGAAGAGTATTTTTTTGTTTATTGTCTCTCTGGTGGTTGTGTTTGTCATGTCAGGGGCT
TTGACGTCTTTAAAACCTGAGCTTAGGCCTCAAGCATCATTATATGGTGTAGCAGATGAG
CTGTCAGGGGCATTCTTTGCAACTCTAATGGGGATGGAAAATCAATATTTTGCCTCAGCA
GTCCCTGAAGATCAAAAAGGATTTCATTTCTCCGGGCTGTCACTCAAACTTGCCACAAGT
ATCAATTTAGAAGACCCCCGCAGTTTTCTAGGAAGAGAGCTGCCGGGCTTTGAACATTTT
GATACAAAAATCATCCTAGCAGGTGAAGGTACAGACTATACGAATATGCCAATGGAATCG
CCGCCTCCAAGTGAAGTCATCAAAGATGAAAAAGAAGCAAATCTAGCTGAGCTGGACAAG
CTTGATGAAGATGAACCGAAAACGCCTGCAAAAGAGCCGGACCAGTCGACAGGAAAACGA
AAAGCTGTGTACATTTATCACACACATAATACGGAATCATATTTACCATTTTTAAAAGGA
GAAACAAACCCAAACAATGCGCGCCACTCAAAAGTGAACGTCACCCTTGTCGGGGAGATG
TTTGGTAAAGCGCTCGATCAGCAAGGAATCGGCAACACAGTGGATAAAACAGAAATCGAA
AAAAGACTGCTAAAAAAAGGATTGAAGTACCCACAATCGTATAATGAATCCAGATTGGTT
GTAAAAGAAGCTCTCGCTAAAAATGATGACCTAGATTACTTAATCGATATTCACCGGGAT
TCAAGAAGAAAGAAAGATACGACAGTAGAAATCAAAGGCAAGAAATATGCGAGAATCGCG
TTTGTTGTAGGGAAGAAGAATCAAAGCTATGAGAAAAACTTAAAGCTGGCGACAGAGTTC
CACCATTTGATGGAGAAAAAATATAAAGGACTTAGTGTCGGTGTGTTTGCCAAAGGAGAA
ATTGGAGATAATGGAATCTATAATCAAGATTTATCTGATAAAGCCCTCCTATTAGAATTT
GGCGGTGTGGATAATAATATGGAAGAACTGAAAAACGCATCCAATGCAGCAGCTGATGTG
TTCAGTGAAATTTTCTGGGACGCAGAAAAGGTAGACGGCAAAGCAAAGGATGAGAAAAAA
CGGTCTTAA