METABLE2 Genes

PROKKA_00025 Bacillus

GenomeBacillus ctg_1:20399-20731
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00025 hypothetical protein
ATGGGCTCATTTATCGGAAAAACCATTATTTTATCGCTCGTATTGCTATTCGGTGTCTTT
TTAGGAATGCAGCAAGCCAATAATGGCATGCTGCAAATGAAAGGGTATCATGATCCGCAA
TTAAAAGGGGCCTTCACTGTCCAAACGAATGATGATCAAGAAAAAGAAGCTTCTATCCTC
GGAACAGCTGTCACACAAAAAGACTTAGCAGAAAAGCAAAAGCAGCTAGAAGAAATGGAG
AGCTTTAATGCCTTCTCTAAGGCTGGAAAAGCATTATCAGATGGTATGACGCATGCAGCC
CGTACACTTTATGATTGGGTGAATGGTAAATAA