METABLE2 Genes

PROKKA_00029 Bacillus

GenomeBacillus ctg_1:25165-25722
ProductCDS heat shock protein GrpE
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK10325
Sequence
>PROKKA_00029 heat shock protein GrpE
ATGTCAGAAGAAAAACAGACACCTGAGCAAGCAGCAGAGGTTGAAGCACAAGAAGAAGCA
GTTCAAGCAGAAACTGAGGAAGTAAAGCACGATGAACAGTCTGCCTTCCAAGAGAAGATT
GATGAATTGCAGCAGCTTCTAGATGAAAAAGAAAACAAAATTCTGCGTGTTCAAGCAGAT
TTTGAAAACTATAAACGCCGTGCTCGAACTGAAGTGGAGACCGTGCAAAAATATCGTTCT
CAACATGTTGTCAGCGACCTTCTCCCAGCTCTCGACAACTTTGAAAGAGCGCTTGGAATC
GATCCAGACAATGAGCAGACGAAAAGTTTGTTAGAAGGTATGCAAATGGTTTACCGCCAG
CTGGTAGAGGCGTTGAAAAATGAAGGCGTTGAACCAATTGAAGCTGTCGGCAAAGAGTTC
GATCCAAACCTTCACCAAGCCGTCATGCAAGTTGAAGATGAAAACTACGATTCAAACATC
GTTGTAGAAGAATTGCAAAAGGGCTATAAACTCAAAGACCGAGTTATTCGTCCATCAATG
GTAAAAGTAAACCAATAA