METABLE2 Genes

PROKKA_00035 Bacillus

GenomeBacillus ctg_1:32035-32964
ProductCDS Na+/Pi-cotransporter
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF02690.9
Sequence
>PROKKA_00035 Na+/Pi-cotransporter
ATGATGGCGATCATTTATTTTTGTGCACTTATTTTCATTTTTTTATGGGCAATGGGTTTG
CTTAGAAAAGGATTAATGGCGCTCACGTCGTCTCGTATTGAGAAATCTCTTCTTCTCTTT
ACAGATCATCCAGTCAAAGCATTCTTGGTCAGTATTGTGTTTACAGGGGTTCTTCAAAGC
AGTTCGGCGTTTATGGTCATCGTTATCGGCTTTGTGAGTACAGGCATTCTCACGTTTAAA
AAATCCATACCCATGATTCTTGGAACGAATATCGGCTCAACATTTACGACAGAATTTATT
GCCATTAAGATGGACGTGTTTATGTGGGTTCTGATTGCAGCTGGTCTTTTATGTATCATT
TTGGGCAGGAAGTCTTTCCGATATGCAGGAAAAAGTTTATTTGGGCTTGGCATGATCTTT
TTTTGTATTCAAGGTTTTTCAAAAATTGCAGGTATGATGACCAGTCAGCCAGAGACACTG
CGTTTCCTTGAAATGATGCAGCATTCCGATTGGACAGCTCTTCTCTCTGGTACAGTGTTC
ACGGCCATTGTTCATTCAAGTTCTGTATGTATCGGTATTTTGATGGGATTTATGAATGAA
GGGACTGTCGCTCTAAAAGAAGGCATCAGCTTTGTTTTAGGGTCCAATATCGGAACATGT
ATTACTGCCGTGATGGCTGCTATCTCTGGCGGTTATGCAGCCCGCCAAACCGCGTATGCA
CACGTCGTGTTTAATGTTCTAGGTGTACTTTTATGTCTTCCTTTTCTCACCTTTATCACA
GAGTTTGTTGCACTTTTAGCAAGCTCTCCTGCCCAGCAGATTGCGCACTTTAGTCTGCTG
TTTAATGTTGCAAGTTCTCTCCTCTTTTTCCCGTTCATCCGCCCTTTTCACGCCTTGATT
TTGTTCCTTCTTCCAAATCAGTCAACATAA