METABLE2 Genes

PROKKA_00037 Bacillus

GenomeBacillus ctg_1:33335-33784
ProductCDS Yqey-like protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF09424.4
Sequence
>PROKKA_00037 Yqey-like protein
ATGAGTCTTCTTGAGCAATTAAATTCTGATATGAAGCTTTTTATGAAAAACCGAGAGAAA
GACAAGCTTATTGTCATTCGTATGGTAAAGGCTTCACTGCAAAATGAAGCAATAAAGCTT
AAGAAAGACAGTTTGACCGGAGATGAGGAACTAACCGTCCTTTCCCGCGAGATTAAGCAA
CGTAAAGACTCCCTCCATGAATTTTCGAAAGCTAATCGCTTAGATTTAGTAGATAAAGTT
CAAAAAGAGATTGACATTTTAGACGTTTATTTACCTGAACAGCTTTCTGAAGAAGAACTG
CAGGCGGTTGTGAAAGAAACAATCGCCGAAACCGGTGCTTCATCGAAAGCTGATATGGGT
AAAGTGATGAGCGCTATTATGCCAAAAGTAAAAGGTAAAGCTGATGGTGCTGTGATTAAC
AGACTTGTCAGCGAGCAACTGTCTCAATAA