METABLE2 Genes

PROKKA_00039 Bacillus

GenomeBacillus ctg_1:35267-36259
ProductCDS SigmaW regulon antibacterial
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF12127.2
Sequence
>PROKKA_00039 SigmaW regulon antibacterial
ATGGATCCATCTACTTTACTATTATTCGTGATTATCGCAGCAGGTTTGATCGTTCTATCG
ATCTTCTTCACCTTTGTACCGGTGATGCTGTGGATTTCTGCCCTAGCGGCTGGCGTAAGA
GTGAGCATTTTTACACTAGTAGGAATGAGACTTCGCCGAGTGATTCCAAACCGAGTGGTC
AACCCGCTCATCAAAGCGCATAAAGCAGGTCTTGATGCGACGATTAACCAATTAGAAAGC
CACTATCTTGCAGGTGGTAACGTAGACCGAGTTGTCAACGCACTGATCGCAGCTCAGCGT
GCGAATATCGAATTGAACTTTGCTCGCTGTGCAGCAATCGACCTAGCAGGCCGTGACGTA
CTTGAAGCTGTCCAAATGAGTGTAAACCCTAAAGTCATTGAAACACCATTTATCTCAGGT
GTTGCGATGGACGGGATTGAAGTAAAAGCAAAAGCACGTATTACAGTTCGTGCAAACATT
GACAGGCTTGTCGGTGGTGCAGGGGAAGAAACAATCATTGCTCGTGTAGGTGAAGGGATT
GTTTCGACAATCGGTTCATCAGATAATCATAAAAAGGTTCTTGAAAATCCTGATATGATT
TCTCAAACGGTTCTTGGTAAAGGATTAGATTCAGGTACAGCATTTGAAATTCTCTCGATT
GATATCGCAGATGTTGATATCGGTAAGAACATCGGGGCGATCCTGCAGACAGACCAAGCA
GAAGCCGACAAAAACATTGCACAGGCGAAAGCAGAAGAACGCCGCGCAATGGCTGTTGCA
CAAGAACAAGAAATGCGTGCGAGAGTTGAAGAAATGCGCGCGAAAGTAGTAGAAGCAGAG
GCTGAAGTACCACTTGCAATGGCCGAAGCACTACGTGAAGGTAATATCGGTGTCATGGAC
TACATGAACATTAAGAATATCGATGCTGATACGGATATGAGAGATTCATTTGGCAAAATG
ACAAAAGGTCCATCTGATAATGAAAACAAATAA