METABLE2 Genes

PROKKA_00040 Bacillus

GenomeBacillus ctg_1:36291-36788
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00040 hypothetical protein
TTGGACATTCTATTTGAAAATCCGCTATTAATCGCGATTATCATCGGTATCATTTCTGCG
GTCTTTGGGAAAATCGGTAAACAAGAGGAAAACGAACAAAAGAACCAGCAAAACAAACCG
GCTCCTCAGCGTAAACCAGTGCCGCAAAAGCAAACAAAACAAACAAGTCCAGATCCGGTC
GTAACGGACCAGCTTGACGATTTTGGCGATGTACATGATCATGGCGGGATGAAGAAACAA
GGTTCACAATCCTTACAGGATCGTTATACAGCTACACTTGCCGAAATGGAAGAAAGAAAA
AGCGAGCTGAATAAAGAGTTTCAATCGCTTGAAAGAGAACTTACAAGGCCAAAAGCAGCA
TCTGCTGGAATGAAGCCAAAAATGATTGAGAAGCTCAACCAAGATACGGTCGTTCAAGGG
ATGATCCTTGGTGAAGTATTTGGAGAGCCTCGTGCGAAAAAGCCGCATCGAACGATGAAA
CGACCATATAAAAGATAA