METABLE2 Genes

PROKKA_00041 Bacillus

GenomeBacillus ctg_1:36995-37276
ProductCDS YabP family protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF07873.5
Sequence
>PROKKA_00041 YabP family protein
ATGGGAAAAAGAAAAAATCAACTTAAAGCATGGCTGACAAGAACACTTGAAATCCCTCCG
GACGTGATGATGGATCTTCCCCGTATTACGATGGTTGGCAGACTCCATATTTACATAGAG
AACCATAAAGGGCTTTTACTTTTCAGTGATCAAGAGGTAAGGCTGATGCTCAAGCAAGGA
CAGTGCATTATTTCAGGAAAAGACTTTGTGATTAAAACGATTTTGCCAGAAGAGATCTTA
TTAGAGGGGAAAATCGATGAGGTCCGTTATATTGATTCTTAA