METABLE2 Genes

PROKKA_00042 Bacillus

GenomeBacillus ctg_1:37295-38485
ProductCDS Putative stage IV sporulation protein YqfD
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF06898.5
Sequence
>PROKKA_00042 Putative stage IV sporulation protein YqfD
GTGAAGAATAAATGGTTTGCCTATTTTATTGGCAGAGTAGAAGTGGAGATAAAAGGAATC
GGTATTGAGCGGCTAATCAATGAGTGCACGAGACAGGGGATCACAATTTTTCAAGTGAGC
CGCCGTCAAGACAGCGTGCGCTTATTTATTCGCCTCTCAGATGTACATGCCTTTAGAAAA
GTGCGCAGACATCATGAGGTGAAATGTTCATTTCATCAAAAGAAAGGGTTCCCGTTTCTT
CTTCTATGGTCGAGAAGAAATATTGGATTCACCCTCGGGATGGCTTTTTTCCTAGTGACG
ATATTGGCTCTTTCAAATATGGTGTGGAAAATTGAGATTAAAGGTGCGAATCCAGAAACA
GAACACCAAATGAGAAAGCATTTAGATGAAATTGGGGTACAAAAAGGGCGCTTTCAGTTT
CTCATGGGGACCCCTGAAAAAATACAAAAGTCATTGACGACCAATATTCAGAGCATTACA
TGGGTCGGAGTTGAACTAAACGGAACGACGTTTCAAATGAAAGTGGTCGAAAAAAATGAA
CCTGAAAAGGAGAAATATACGAGTCCTCAGCACATCGTTGCCAAGAAAAAGGCGGTCATC
ACGAGAATGTATGTAGAAAAGGGGGAACCGCTTGCCCAGGTTGATGAACATGTGAAAAAA
GGGCAGATGCTCGTCTCAGGTTTAATTGGGAGTGAAGATCAGAAAAAAACGGTCGGAGCC
AAAGCGAAAATCTATGGTGAAACATGGTACCGATCTGAAGTTTCTGTCCCTCTCCGAACA
TCTTTTGATGTCTTTACGGGTAAAATGAAGACAAAGCACAAGCTCTCCTTGTTTGGAGGC
TCCATCCCATTTTGGGGATTTTCCTTTAAAAAAGATGATTTTCAGCAGCCGAAAACAGAA
AAAGAAGTTCACCCGCTTCATTTTTTGAATATGCAACTACCGTTCTCCTATGAAAAGGAA
ATCACACGAGAAAGTGAAAAAATAAATCGAGAATACACAAATAAAGAAGCGGTTCAAGCA
GGGATTAAAATGGGTAAAAAAGAATTAGAAGAAAAGCTAGGTCAAACAGGTGAGGTGAAA
AGTGAAAAAGTTTTGCACGAGACAACAGGGAATGGTAAAGTTAAGTTAATCATCCTTTAC
CAAGTAATAGAAGATATTGTTCAACCAACACCTATTGTTCAGGGAGACTAG