METABLE2 Genes

PROKKA_00044 Bacillus

GenomeBacillus ctg_1:39524-41677
ProductCDS 7TM-HD extracellular
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF07697.5
Sequence
>PROKKA_00044 7TM-HD extracellular
TTGAGAAAGAATCAGAAAGGCAGTAAGCGCAAAAGGCTGCTGTCTAAAAAAGAACCTCAG
AAAATGGAGCGCTCACGCTATTTAAACGTACTGCTATACGCTGGTTTAGCAGCCATTCTG
TTTGTGGTGCTCTTCTTCCATGTAAAGCCTGAATCGCTCGACCTAGATTTGTTTTCAGTG
AGCGAACAGACCATCTATTCTCCGTCTACCGTTGATGACCAAGAAGCAACAGAAGAAAAG
AAACAAGAAGCAACGGATCAAGTGGAAGACCAATATACACTCAAAAAAGCGTATTCTGAT
AATCGTGTTGACCTCATTTCATCCCTCTTTGAAGCCATTAAAGAAGAGAAGAAAGCAGCA
GCTGATGACAAAGAGAACCCGCCAACAGATCAAGAGATGGTGAAGCGTGTAAAAGAGAAA
CTCACAACCGATATGCAGGAAGCTGTTTCGGATCAATCGATTAAAGCACTGCTCCAAGCA
AGCGACGAAAATCTTTCTTTTACAAAGGACTCCATCATCACAGTGGTCAATTCTCTCATG
AGTAAAGAAATCACAGCTTCTAAGCTGCAAGATGAAAAGAAACAAGTGAAAGCAGAGCTT
GAAAACAATTCGATTCCGTCAAAATATTTAAATGCAGCGAAAGAAATTGGTGAATTTGCG
CTTATTCCAAACTATGTATTTGACCCGGTCGCAACAGAGAAGAAAAGACAAGAAGCAGCT
GATAATATCCAGCCAGTTCAAATCAAGCAAGGGCAAATTTTAGTGGAAGAAGGAGAGCTC
ATTGACCGCGAAGTGTATCGCAAATTAGAACTGACGGGTCTTTTAAACAGTTCCAATTTG
TTTAAGCCTGTAAGCGGTCTTATCATCTTAATCGGTCTCTTCTTAGCCGCGATTGTCCAC
TCACTGGAATCGAGGAAAAAGTCGCTCGTCCATAAGAATAAATCGTTACTGCTGTACTCG
CTCATTTTCACCATTATTTTAATCATCATGGAAGTATTCAGTCTCTTCCAGGAAACGAAG
TATACGACCATAGGCTATGTCGTGCCTGTTGCACTTGGCACGATGCTGATTAAGCTGCTG
ATCAATGAGCGGCTGGCGATCTTCTCCGGCCTTGTATTTGCCCTTTGCGGCAGTATGATG
TTTAATCAAGGAGTAACAGGTGTCTTTAACTATGTCATCTGTGCTTATTATCTAATAAGC
GGGATGGCAGGGATTTTATTTTTGAGAAAACACAATGCGAGATCGAAAATTTTGCAGGCC
GGGCTTTGGGTAGCTTTGGTGAATGTACTTGTCGTGCTGTCCATTACGCTGATTCAAAAT
TCTTCTCCATCAGGGCTTGAAATAGGTGTGAACCTCATCATGGCGATTGTGTCAGGGTTT
GCATCGGCTATTTTGGTTATTGGGTTAATGCCAGTCTTTGAGAGCATGTTTGGCATTCTT
TCGACCATGAAGCTTATTGAATTATCGAACCCGAATCATCCGCTGCTGAAAAAGATCTTA
ACAGAGACGCCAGGTACATATCATCATAGTGTCATGGTGGCGAATTTAGCGGATGCTGCA
TGTGAAGCAGTCGGTGCAAATGGATTGTTAGCAAGGGTTGGAGCTTATTATCATGACATT
GGAAAAACGAAAAGACCCCAATACTTTATTGAAAACCAAATGAACATTGATAATCCGCAC
GACAAGCTTTCTCCTCAGCTGAGCAAGAATATTATTATTGCCCATACGACAGATGGTGCT
GAAATGCTGAGAGAAAAGAAGTTTCCAGAGGAACTTGTGGACATTGCAGAACAGCATCAC
GGAAAGTCCCTGCTGAAGTTCTTTTACTATAAGGCAAAAGAACGGGATGATCAGGTGACA
GAAGAAGAATTTCGTTATCCTGGTCCAAAACCGCAATCGAAAGAAGCGGCCATTATTTCT
GTAGCTGACAGCGTGGAAGCGGCGGTTCGTTCGATGCATAATCCAAACCCTGAGCGGATT
GAAAAGCTTGTGAAGGGCATTATTTCAGATAAGATGCAGGATGGACAATTTAGTGAATGT
GATCTGACATTTAAAGAATTAAATATTATTAGCCAAACAATTTGTACAACATTAAAGGGG
ATTTTCCATTCTCGGATTGAATATCCAGATGCCCCGAAGCAGAAGGTGAAGTAA