METABLE2 Genes

PROKKA_00049 Bacillus

GenomeBacillus ctg_1:44078-44221
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00049 hypothetical protein
ATGTTGAATTTTACATGGAACGTATTTTCACAAACAGGAAGCGTTGACACGTATCTGCTT
TTCAAAGAGTTAGAAAAGGAGAACCTGGAAAGACCCGATGTACTTGAAGAAGAAATAGCA
CGACTTGATTTTCCAATCTTATAA