METABLE2 Genes

PROKKA_00055 Bacillus

GenomeBacillus ctg_1:50196-50696
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK00124
Sequence
>PROKKA_00055 hypothetical protein
GTGGAGGGATGGAGAATTAGTCACCTGAATGAACGTAAAAAAGAAAGGACGATTTATGTC
GATGCAGATGCTTGTCCTGTAAAAGACGAAATCCTTTCTGTTGCATCTCAATTTCAAGTA
CCTGTGACTTTCATTGCTTCATATGAGCATTTTCAAACCAAACGATCACCACTTGAAGAT
TGGCGGTTTGTTGATACACATAAGGAAGCAGCAGATTTAGTCATTGCAAACTTAGCTGTC
AAGCACGATATTGTTGTCACCCAGGATATTGGTCTGGCCTCCTTACTGCTTCCAAGACAA
GTCATTGTTCTGTCTGAAAGAGGACGAATGTACACAAACGAAACAATTGATTTTGATTTG
GAACGCAGGCATGTTTCCAGTAAACAGCGAAGAAAAGGTGTATACGGAAAAGGTCCCAAA
AAGCTTTTAGAAGAGGATAAAAAGCGATTTATTGCCCAACTACAAAAAATCCTGTCGAAT
CATGAAGGATTTTTGAATTAA