METABLE2 Genes

PROKKA_00060 Bacillus

GenomeBacillus ctg_1:55375-56496
ProductCDS Putative GTP cyclohydrolase 1 type 2
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:P67272
Sequence
>PROKKA_00060 Putative GTP cyclohydrolase 1 type 2
TTGGCTAAAACAGTGAACGGGCATGAAATCATCCAATTATTTGAGCAATTTTCACCAAAG
GCATATGCGGTGGAAGGTGATAAAATCGGGCTCCAGATTGGAACGCTGAATAAAAAAGTG
ACCAATGTCATGATCACCTTAGATGTATTAGAAAATGTGGTAGATGAGGCAATTGAGCGG
AAGGTGGATCTCATTATTGCCCACCATCCGCCAATTTTCCGTCCATTAAAACATGTGGCG
ACAGATCAGCCGGCAGGACGGATCATTGAGAAATGCATCAAACATGATATTGCGGTGTAT
GTAGCACATACAAACCTGGATGTGGCTGATGGAGGAGTCAATGACTTGCTTGCAGAGGCT
TTAGAGCTCGGGGAAACAAAAGTGCTAGTTCCAACATACGAAGATCCAATTAAGCAGCTA
GCCTTGTATGTCCCAGTGGAATTTGAAGAGGCCATCAGGACGGCTTTAGGAAATGCGGGA
GCTGGCCATATTGGCAACTACAGTCATTGTGCTTTTTCAAATGAAGGGACAGGCAGTTTT
CTGCCATCAGAAGAAGCTGTGCCATTTATTGGTGAGACGGGTAAATTGGAATTTGTGAAA
GAAGTACGAATCGAAACCATTTTGCCAGCAAGTATTGAAAAACAAGTGATTCGTGAAATG
ATCAAAGCACACCCTTATGAAGAAGTGGCTTACAGTGTACACACGACAGATCTTCCTCCT
ATTCAAAAAGGCCTTGGCCGTATTGGAGAATTAAAAGAACCTATGACACTTAAAGACTTC
ACTCAATTTGTGAAAACGAAGTTAGATGTGAATGGAGCGCGTTTTGTAGGAGATCAGGAA
GCGGTCGTGAAAAAAGTAGCTGTGCTTGGAGGAGATGGAAATAAATATATCCATCAAGCG
AAAAGAATGGGTGCAGATGTGTACGTGACTGGCGACCTTTATTTCCATGTCGCTCACGAT
GCCATGATGCTTGGACTGAATGTAGTGGACCCAGGTCATTACGCAGAAAAGATCATGAAA
GAGGGCGTGAAGACAAAGCTAGAATCACTATGTACAGATAAAAAATATGATGTGCAGTTC
TTTGTATCAGAATCAAACACAAACCCGTTTCAATTTGTGTAA