METABLE2 Genes

PROKKA_00062 Bacillus

GenomeBacillus ctg_1:57634-58347
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00062 hypothetical protein
ATGTTAGGGCAAAGGCCTATGGGCGATTTTCAGCCGCATCGCCCCTCACGCCGGCACCTT
GGAAATGGCGGACAGCCCGGGATTTTTCAACGGAGACAGCAAGCTCCGATCGAACAGCCT
TTTCAAGGGCAAGGCAACCAATTTCAACAAATGATGCCTCGCTCTCCGTCTGTACAAGGC
GGCGGTCTACGCGGGATGGGTGGCATTCCTGGAGGCGAAAGCCGTGCACTAGGCGGCGGA
GCCGGAATTAAGGGCATGCTGGCAAAATTTCTTCCTGGAGCTGGAGGAGCAGGGATCTCT
GGAGCTGGAGGTGGTGCGGGATTACAAGGAATCCAGAGCTTCGCAAACCCTGCGAACCTT
TCAAGCATGTTAGGAAATGTTCAAAAAGTACTCGGAATGGCGCAGCAATTCACGCCTATG
ATTCAGCAATACGGTCCTTTAGTCAGAAATTTGCCTGCCATGATTAAACTCTATAGCCAG
CTTGGCAGTGCGGATGATGATGAAACAAATACGAATGATGCAGACGAAGAACCAAAAGAA
ATCACTGCAGAAACAGACGTTCCGCACGAACCAGTTGATGATGAAATAGAAGAAGGAAAA
GAAGAAGAACCAGAGGACATCCTTGTCAAAAAAGGGACTGTACACACATCAGCTGCTCCT
GAAGCAAAACCGAAAAAAAGATCGGGTAGTTCCATTCCGAAACTATATGTCTAG