METABLE2 Genes

PROKKA_00065 Bacillus

GenomeBacillus ctg_1:60775-61035
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00065 hypothetical protein
ATGGAATTGATTTTAATTCAAAAAATTGTGTTGCAGCGTCTGAATCAGATCACAGCAAAT
GACTTGTTAAAGTATGCGAAACAGTATGGGGTCAGCTTAACATCCAATCAGGCTGCTGAG
GTCGCTAAACTCATGAATGGGAAAAACGTCAATATTTTTAATGATGCAGAGCGCAACCGG
CTGCTTAAGCAAGTGGAAGCGATTACGTCTAAACAGACAGCACAGACCGTCAATGATCTG
TTTAATCAATTCACAAATTAG