METABLE2 Genes

PROKKA_00066 Bacillus

GenomeBacillus ctg_1:61170-62051
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00066 hypothetical protein
ATGGCAAATAGTAAACAGCATAAAAAGGAATCAGTGCCTCATTTTATTTTGAGAATTTTT
CTGATTCTAGTAGGAGCTGCATGTGCAGCAGTCAGCATTGAATTATTTTTAGTGCCAAAC
AATATTATTGATGGAGGCATCATCGGTATTTCGCTTATTTTGGATTATCTTTTTACGGAT
AACCCATTCATTAATTTCGCGACGATTGTTGTCATTTTAAATATTCCATTTATGATATCA
GGATACAAACATATTGGGAAAACCTTTTTGGTTTCCACTGTGATTGGGATTGTCAGCTTG
GCCGTGATTGAATCTTCACTCCATCATGTAGAAGCATTTACGACGCAGCCGATTTTAGCT
ACTGTATTTGGAGGGCTGTTACTCGGGTTTGGCGTTGGGCTTGTGATACGGAATGGAGGC
TCAATGGACGGAACGGAAATCTTAGGAATTCTTCTGACCAAAAAAATTCCTTTCTCCGTC
GGTGAGTTTGTCATGATCGTCAATGTGTTCATTTTTATTTGGGCGGGCTTTGTCTTCGGA
CCGGAGCAAGCTATGTATTCTGTCATGACATATTATTTGGCAATGAAAACAATTGATGCT
GTCATTCAAGGACTAGATGAAACAAAAGCGGTCATTATCGTTTCGGATTATTATGATGAA
ATTTCAGATGCGATCCTTCATCGTCTCGGCAGGGGAACCACCAAGCTTAGAGGAAAAGGC
GGTTATACCGATGAAGAAAAAGATGTCATTTACGCCGTCGTGACAAGACTTGAAATTACG
AAGCTGAAATCTATCGTGTTTGAAATTGATGGTCAAGCCTTTATTACGATTATGGATACG
CATGAAACAAAAGGCGGTAAATTCAAAACAGCCATTCATTAG