METABLE2 Genes

PROKKA_00071 Bacillus

GenomeBacillus ctg_1:65517-66095
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00071 hypothetical protein
ATGTTACGTTTAGGAATTGATATCGATGGCACAGTCACGGCGCAGGACACCTTTGTCCCC
TACTTAAATGAGTCGTTTCAATGTGACATCACACTAGATGATATGACGGAATATGATTTG
ACGAAGCTTTTAAAGATTTCAAATGAAGAATTTTGGGGCTGGATGAATGAGTATGAGCCT
CTTATTTATAAACAGGCAAAGCCTGCCGAGGGTGCAAAAGAAATCCTCAATCAAATGAAA
CATCATCATCAATTGATTTATATCACAGCCAGAAGGCAGCATCACTCAGACATCACCTAC
AAATGGTTTGAGGAGAATCATGTCCATTACGACGATATCGAGCTTGTTGGCGGACATCAT
AAGGTGGAAGCTGTTCAAAAACATAAGATCGATGTGTTTTTTGAAGATCACCATGGCAAT
GCCACAATGATTGCAAAAGAAGCTGACATTCCAGTGATTCTGTTTAACTCACCGTATAAT
CAAATGCCAATTGATGAACGGATCATTCGCGTTAATAACTGGCAAGAAGCATCCCAATGG
ATCAAACAGTATGAAAAGCGTCTGCAAACTGCTTACTAA