METABLE2 Genes

PROKKA_00072 Bacillus

GenomeBacillus ctg_1:66235-66597
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00072 hypothetical protein
ATGGAAAGAGACGAAGATTTCAGAAGAAATGATCGTGAAATCGACACACACTTTAGTAAT
GATGATGGCTATTTAGAGGAAACAGCTGCTGAAATAGCAGAGCCATATCAAGCATCAAGA
GATCGTGAAGACAGAAGAGAACGTGACCATGTAGGTGACGATTCAGGCAGTAAGGGGATA
GGCTATACAGCACTCGCGATTGCGATTATCTCATTATTTGTCTTGCCGGTGCTATTAGGC
GTAGCGGCAATCGTCGTTGGTTATATTGCAAGAAGAAAAGGAGCACATGCGCTTGGCGCG
TGGTCAATCGGGATCGGAATCGTTTCCGTCATCCTCGGCATCTTTATCACCCCGTTCTTT
TAA