METABLE2 Genes

PROKKA_00074 Bacillus

GenomeBacillus ctg_1:67868-68170
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00074 hypothetical protein
ATGCGGCGAATTATTTTTTTACTAGTCAGTTTGTTTGTCCTCTTTATTATCTTTTTTGAT
TTAAAAAATGGAACGATCCCCGTTCAGGAAGGCCCTGCTGTTCCCGCCAGCGCCTTTCAA
ACAGCTGAAAAACAGGCATATAAAACTGTCACTGTTAAACAAGGACAAACCGTCGTCTCT
ATCGTGCATACAAGTAAGCCATTAGATGAAGTGATCGAAGACTTTGAAGCACTGAATCAA
GGCGTCAAAGCGAACGAAATTCGGGCAGGCAGCACATACAAGTTTCCGGTCTATAAGAGA
TAA