METABLE2 Genes

PROKKA_00076 Bacillus

GenomeBacillus ctg_1:69147-69899
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00076 hypothetical protein
TTGAACGTATTTAGTTTATTGTTAAAAGGAATTTATTCACCAAAAGATATTGCCAGAGCA
CGTTTTACTGGGATTGGAAAGGCCATTTTATTCATCTTTATCCTTTCGATCATCGCAGCT
GTCCCCCAGGGCTATCATATGAGCCAAGAGATTTCAAATGCGATGTCAGGATTTCAACAT
GTGATTAAAAAAGATTTACCCGACTTTTCCATTGAAAAAGGAACGCTTCAAGCGGATCAA
AGCACGCCGATCGAAAAAGAAGAAAATGGCATCACGATTATCTTTGATCCCGCTGAAAAA
ATAAAATCAAGTGAGCTTGAATCAAAACAAACAGCCATTGCGTTATTGAAAGAAAAAGCA
GTGATTGCCATTGACGGACAAATGACAGATATTCCATACCAGCTGCTTGGCGGAACACTC
ACAAAAGATGAACTTGCCAGCGTCACAAACCAGAATCAAGCGATCATTATCCCTGTCATT
TGTGTCCTGCTGTACCTATCTACTGCTGCTCTCATGTTCATCAGCGCAACATTCCTAGCC
ATGCTTGGCACATTTATTAAACGAATGCAGCAAAAAGAGCTGTCCTTTCAAATGCTTTGG
AAGCTCTCTGCCTATTCACTCACATTAACAACCGTCTTTTTCGCCATCATGAGTGCATTA
AACACGCCGGTTGCAAACTCATTTTTATTAAATTGGGTGATTAACTTTATTTTCTTATAT
CTTGTCGTTAAAGAAATACCTGCAAAAAAATAA