METABLE2 Genes

PROKKA_00077 Bacillus

GenomeBacillus ctg_1:70043-70528
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00077 hypothetical protein
TTGGACGTGCTGTATTGGATTTTGATCGGCTGTGCATTTATCATTGCGTTTGTGGGACTT
GTCTATCCAATCATTCCTAGTGTGGTTTTCATGGTTCTTGGGTTTATTTTATATGGGCTC
TTTTTTAGCTTTGAGAAATTGACGCTCACCTTTTGGCTCATTCAAGCCATGTTTACAGCT
GTGTTATTTGCTGCGGATTATGTCTCCAATCTGATTGGGGTGAAACGCTTTGGCGGCAGC
CGGGCGGCCATTTGGGGAAGTACCATTGGGCTTTTAGCCGGTCCTTTTGTGATTCCGATT
GCTGGAATTATCATTGGTCCATTTATCGGCAGTGTCATCGCAGAGCTGCTCGTTCATCAA
AAAGATCTGAAGACAAGTGTGAAAGTTGGGCTTGGCTCATTAATTGGTTTTGTGTCAGGC
GTATTTGCAAAAGGGCTGATTCAAGCACTGATGCTGGGAATCTTTTTGTTTTATGTGCTT
CGCTAA