METABLE2 Genes

PROKKA_00079 Bacillus

GenomeBacillus ctg_1:71444-72730
ProductCDS Major Facilitator Superfamily protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF07690.10
Sequence
>PROKKA_00079 Major Facilitator Superfamily protein
ATGAGCAGATTAAAGAAAATGTTCGGGGACATGGATGTCACAAGAGATTTATTGCTCCTC
CTCACGATTGGCGGATTATACGCACTTGCGATTGCGCTTTCGAATACGTTTGTGAACGTG
TATTTATGGAAACAGTCTGGGCGATTTACAGACCTTGCGATTTATAACTTGGCGATAGTT
GTCCTTCAGCCCATTACCTTTTTATTTGCTGGTCGGCTCGCTAAAAAAATAGATCGTGCA
TTTGTCCTTCGTTTCGGTGTCATCTTCCTAGCCGCTTTTTACTTAATTGTTCTCATGGCA
GGAGAGCAAGCGGCAGCTCGGCTCGTGTTATTAGGCAGTGTGCTTGGAATCGGCTATGGT
TTTTACTGGCTTGCCTTTAACGTGCTCACTTTTGAGATCACTGAACCTGAAACAAGGGAT
TTCTTTAATGGATTTTTAGGAGTGCTTACCTCTACAGCCGGTATGATCGGGCCGCTCATT
GCAGGAATTGTGATTTCTCAATTAACGGATGATACTGGCTATACAGTGATTTTCACTTTA
TCGCTTTTTTTGTTTTCACTAGCGGTTGTGATGAGTTTTTTCCTCAAGAGGAGACAATCA
AAAGGAAAATTTATCATTAAGCAAATTTGGAAAGAGCGCCATGCGGACGAGAATTGGCGT
AAGATCACAACTGCTCACTTTTTTCAGGGGCTCCGTGAAGGCGTGTTTGTCTTTTTAATC
AGTGTCTTTGTGTTTATTGCAACAAACAGTGAGCTTGCTTTAGGCACATTTGGTCTAGTC
AATTCAGGTGTTGCCTTTTTCGCCTATTTTTTTGCTACCCGTTTGATTAAGAAAAAATGG
CGTAAAAAAGCGATTATGTTTGGCGGGCTTATTTTATACGGCGCTTTATTTTTAATCGTC
TTTCACTTGTCCTATGTATCACTGCTTATGTACGCTGTAGCCATTGCGATCGGCTACCCG
CTTCTGCTTGTTCCGTATGTCTCTTTAACTTACGATGTCATCGGTCATGCCAGATATGCA
AGGAAAGCCCGAATTGAATATATTGTCGTCAGAGAACTATTTTTAAATGCAGGGCGTATT
TGTTCGATTGTCTTTTTTCTTTTATCTGTCACCTTACTGGGCGATCGGCTTGGGATTCCT
GCTTCACTTGTCGTACTCGGAGCGGGGCACACCCTTATTTATTATTTTGTAAAGGACATT
CATTTAAAAGAGAAAACAGCTGATATAGAAGAGGCTGACGGTCAAAAGCCTGTTTCTCAA
ACGAACCTTATGAAGGGAGAAAGGTAA