METABLE2 Genes

PROKKA_00086 Bacillus

GenomeBacillus ctg_1:79688-80188
ProductCDS YceG-like family protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF02618.10
Sequence
>PROKKA_00086 YceG-like family protein
ATGACGAAAAAAAGCATCCAAACGTTTGCAGCAGGTATGATTCTTGCAACTGGTGTTCTG
GCGATCGTCTTTTTCCTTACTGGAAAAGATGAAGCGGCAGCTGATTCTACAACAAAAGAA
ACCCTCGCAGCGAAAGTGACAGACACTGACGTGAAAAATTACTTAGACTCTAAAAAAGAA
GTCTCCGTCAGCCGTGAAACATATCAACAACTTCTTGATTATAAAGAAAAAGCGCTGAAA
GCAAATGAAGACGGCGATTCTCAGAACGATAAACAAACAACGGACAAACCAAAAGGCAAA
ACGGTTAAATTCGTGATTAAAAACGGTATGAGCACAAGTGATGTTTCAGACATGCTTGAA
AAGGACGGAATCATCAACTCGTCTAAAGATTTTAATGATTACGTGATAGACGCAGGCTAC
CATAAAGAAATTCGTGCCGGCAAATTCAATTTAAAAACAGGTATGACATTCAAACAAATT
GTCAAAGCCTTAACAAAATAA