METABLE2 Genes

PROKKA_00087 Bacillus

GenomeBacillus ctg_1:80185-80532
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00087 hypothetical protein
ATGGAAATTGCAATTATCGGATTGCTTGTTGTCAGTATTGTACTGATCGCATTCTCATAT
TTTCAAAGAGAGCCGATTAAAGAAGTCGAACAGGAACTTGAAACACTTCAACTATCTGCA
ATGCAAGAAATCTATAAACTGAAAAAGAAAATGAAGGTTCTTGAAGAAGAATTGCTTGAA
ACAAACATCGTTGTCCGCAAGCATTCAGAAATTGATCCATCTATTGCAAGACAAATCATT
TCAAAGCATCAAAATGGCATGTCTCCTGAGGCGATTGCGCGCGCTGAGCATGTATCTGTA
GAAGATGTGAACATGATCATTAAAGACAACGAGAGGGTGCTTGTATGA