METABLE2 Genes

PROKKA_00089 Bacillus

GenomeBacillus ctg_1:81183-81743
ProductCDS putative 5-formyltetrahydrofolate cyclo-ligase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:P75430
Sequence
>PROKKA_00089 putative 5-formyltetrahydrofolate cyclo-ligase
ATGAAAAAGGAGCTCCGCCTTCAAACATTAGCCATGCTTGATCAGATAGGCGCTGAAGAG
TTCAATCGCTACGCCGCTCTAATTCATGAACACGTGCTACAGCTGTCAGAATGGAAACAG
GCGAAAACGATTGCTTTGACTATGTCTAGGGGAAAAGAAATACCGACAATGCCTCTGATT
GAAAAAGCGTGGGAAGAAGGAAAAACAGTTTGTATTCCCACCTGTTTTCCGAAAACAAAA
GAGATGGTGTTTTATGAATATACACCTGAAACAAAGATGACATCCAGCTACTTTGGGCTA
TTGGAGCCAGACCCTCTTGAGTCTAAAGCTGTACATAAAGAAGCCATTGATTTGATCATT
GTCCCTGGGGTGTGCTTCGATCAACGTGGTTACCGGATTGGGTTTGGTGGGGGCTATTAT
GATCGCTACTTAGCGGACTACCACGGGGGAACCATTGCCCTTTGTTTGTCTTTACAGCAG
ACGAGGCATATTCCGGCTGAAGCGCACGACATACCGGTGTCTATGATTGTCAGTGAAAAA
GGTACGTTATATCAAAAGTGA