METABLE2 Genes

PROKKA_00090 Bacillus

GenomeBacillus ctg_1:81829-82092
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00090 hypothetical protein
TTGAAAAAATTTCGAGGAAAGAAAAGATACTTCCGTAATTTGTGGGAGGAAGTGAATACT
TTTGACTTACAACTCGAACATGATTCATGGGTTTATTTTTGGCATACACACCTTGATTTT
TTTGGAGTCGGAAAAATAAGAAGAGAGCATATCAAAGCGTTCAAAGATTTAATCGCCCTG
CATCAATTTGACGTTTCTTATGATCAATCAGAGTGTGAAGAGTTCTATTATATTCAATCA
AAAGAACAAGGGATTAGAGTGTGA