METABLE2 Genes

PROKKA_00091 Bacillus

GenomeBacillus ctg_1:82182-82355
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00091 hypothetical protein
ATGAATAAAATGATTTGGAGCATTGTGTTCACACTGTTTGCATTCGTTCTTGTGCAAAAT
CGTTATCGGGTCATGAATTTGATCTTAGGTCAAAACCAAGTGCGTCACTTTTTTATTACA
TGGCTGATGAAAATCCCATATTTTCGGACGAAATTTATTCGCCAAGCATTCTAA