METABLE2 Genes

PROKKA_00093 Bacillus

GenomeBacillus ctg_1:84042-84254
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00093 hypothetical protein
GTGAAAATAATGAAAACGTTATATGATGTACAGCAGCTGCTCATGAGATTTGGAAATTAC
GTGTATTTCGGAGATCGTGAAGTGGAATTAGAATTTATGGCAGATGAATTGAAGGAAATG
TACACATCGGGCATTATCGATCGAACTGAATGGTCAAACGCAATGACCATCCTTCAAATG
GAACTAGCCAAATTAAATCGAAAAACAATGTGA