METABLE2 Genes

PROKKA_00096 Bacillus

GenomeBacillus ctg_1:87438-88559
ProductCDS Gamma-D-glutamyl-L-diamino acid endopeptidase 1
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q03415
Sequence
>PROKKA_00096 Gamma-D-glutamyl-L-diamino acid endopeptidase 1
ATGAAAAAGTCGTTTGGCACAATTGAATGGCATCTGGATGAGGCAAGGAAGGAGGATGTG
GCAAAGCAGCTTGGTATAGGAAAAGAAGCTTTCCGTTTGTCCAATCAGTCAAATACGGAG
CACCTCCTTTTACCGGGGTATAGACTTCCAGAAGGGACCCATTCATTTCAATCGGTAGGT
GAGGTGCAAAGCTTCATTGCGCCTTACCGGCTCCAGCAATCAGATGATTGGATCAGCGGC
ACATTTGAATATGATAGCGCTCACTTAGAACGAGAGCTTCAATATTTGAAAGCTGTTTTT
CCTTTTCTTCAGATGAGTGTGATTGGTCAATCAGTGCTTGATACGCCCATTTATGAAATC
CGTACGGAGCCTGTACAACATTTACATTCCATACATGTTAATGCCTCTTTTCATGCAAAT
GAATGGATCACGACCTCCGTTTTATTAAAATGGCTTAAATCACTTTGTTTAGCGGCCTCG
GACCCAGTGCAAGCAAGACATCATGAAGCGGTTCGTATATTGCAGACCACTGCTTTGTCT
ATTGTCCCGATGGTAAATCCAGACGGTGTTGATTTGGTTCGCAATGGTCCAGAATCTTTA
GGGTTGTGCCGTGAGGAGTTTGCGCTGCTAAATGGTGGATTTTCCGATTATCGAGAATGG
AAGGCGAATATTCGAGGAATTGATTTAAACAATCAATTTCCTGCTTATTGGGAAATCGAA
TATTATCGTAATAAGCCGAAGGCACCGTCTTATAGGGATTTCCCAGGGCATCAGCCGTTA
ACAGAACCAGAAGCCAAAGCAATGGCACATCTCGCCTTACGAAAACGCTTTGATCGGCTA
ATTGCCCTTCATACACAAGGAGAAGAGATATACTGGGGTTTTCTTGGCCACGAACCGGCC
ATTTCAAAAGAGACGGTCGAACGGTTAGAACGGGTGAGCGGTTACAAAGCGATTCAATAT
CTTGATAGCTATGCAGGTTATCGTGATTGGTTTATTTATCAATGTAAAAGTGAGGGATAT
ACGGTGGAACTTGGGCGAGGAAAGAACCCGCTTTCTATGAGTCAATTTGATTCGATCTAT
GAAAAAACAAAGCGGTTATTGTGGGAAGCATGTAAGTATTAA