METABLE2 Genes

PROKKA_00008 Rhodococcus

GenomeRhodococcus ctg_1:8646-10316
ProductCDS Calcineurin-like phosphoesterase
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF00149.22
Sequence
>PROKKA_00008 Calcineurin-like phosphoesterase
GTGAGACGTACGACCATCGCGATAGCAGCCGTGACCGCGGCTCTCGCCGTTCCCGGCATC
GCCCCCGCCGAATCCCACGCCGAACCCAGTTGGGGCAGTTCGTCCTTCGAATGGGGTAGC
TCTTCGGGCGAGAACAACACGCCACCCGCAGCGCCCGGCGTCAGCGTCCCCGGCGGACGG
TACGAGCACCCCGTCGACCTGACCTTCACCGCCGAGCGCGGCGCCACCGTCCGCTACACC
TTGGACGGAACGACACCCACCACCGACAGCCAAGCTGCCACGCCGGGACGTCCGTTGCAG
ATCGCACAGGACACCAACGTCACTGTCGCCGCTTTCCGCGGCGATCACGCGAGTGCGGCC
GTCTCGTTCGGCTACCTGATCAAGACCTCGGAAAAGCCGCTGGCTCAGGTCGTCGTAATG
TCCGACGTCCACGTCGGCGATCACGCGAACAATGACAAGAAGTACGAAAGCTTCTTCGAC
ACAATCGGTTCCATCTTCCCGAAACCTGACGCGATCCTCTCCAACGGCGACATGATCAAC
GACAACGGAGACGGCAAGGGGCCCGACCACAAGATCGTCGCAGAAATCTTCCAGGCAAAC
CTCGCCAGGAAGGGCATGAACGAGACACAACTCCTGATCTCCAACGGCAATCACGATGCA
AGTCTCGCGGCGATCAGAGCCGGATATCCGGCGGAGTGGTTCCCGGATTCCGGTGGCGGA
TACTACGAATCCGACGTCAGCGGTGTCCATCTCTTCACGGTCAACACCGAGACATACAAC
AATGATTCAGCGCAACGTAATTGGCTGAAGTCCCGCCTGACCGAAATCACTTCGGAATCC
GGAAACCTGACCAAGCCGATCCTGGTCCAGGGACACCGGCCGGCAAGCAACACAGCCATG
GACGGCCAACAGGCGTCGAATCCTCGACTGACCGAAGACTTGAGCGCCTTCCCTCAGGCA
ATCTTCTTCTCCGGGCACTCGCACCTGAACAACAACGACGACCGGTCGATCCATCAACGC
GACTTCACGGCGGTCAACGACGGCTCGATGTCCTACATCGAAATCGATCACGGCTACCAG
ATGGTGACCGAGTCCGGTCTCGCGAACCGTTTCGAATCACCCACTGCCCAAGCTCTCTTC
GTGGAGGTCTACCAGGACCGCACGGAAATCAACCGCATCAACATGGCGGCAGACAAGCAC
GACATCTACACCGGAGGTGCGTGGTCAGCCAACTGGCAGCCGCCGTACTCGAGCGCGGGC
ACGCTGAGCGGCTCGGGTTGGACGGTCGAACTCGACGGGTCGACCAACCAGCAGATCAAG
GACAACTTCCGCTACACCTCGGGTGCACGAAACACGAATGCACCGGAATTCACCACGGCC
ACCCCACTCTCGGTGAGCACCGGAGCGAACGGTGAAACTGCGCTACGGATCGCGCAGGCG
AAGGACGACCAGATGGTCCATCACTATGCCGTCGAGATCACGGACACAGCCACCGGAGCG
AAGGTGGTCTCGTCGAAGGTGCTCTCCGACTTCTACTTCATGCCACGGCCGAACAGCCTC
GACATTCCGATTCCCGATGCCGCAGCGGGCACCGCATACGAAGCCCGCGTCGAAGCCGTT
GACGCATACGGCAACCGGTCACCGGTGACAACCCTGGCCTTCACCCGCTGA