METABLE2 Genes

PROKKA_00011 Rhodococcus

GenomeRhodococcus ctg_1:12454-14013
ProductCDS Long-chain-fatty-acid--CoA ligase FadD13
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:O53306
Sequence
>PROKKA_00011 Long-chain-fatty-acid--CoA ligase FadD13
GTGAGCGAGCTTCACCTACCCAACCGGATACGCCACTCGGCGTCGACACGGCCGTCCGAT
CCGGCGATCACGTGCGGCGACCGAACAGTGACATGGGCTGCGCTGGATGGCGAGACCAGT
GCCTTGGCGAGTGCGCTGGCGGGAGTGACCGCAACGGGTGCTCGCGTCGGTGCGCTACTG
CGGATGGGGCTCGAAGGTGCGGAAACCTTCATCGCGTGTGCGAAGGCGGGCGCAGTGTTC
ATCCCGTTGAACTGGCGGCTCAACCCACTCGAACTCGTCGACATCGCCGAGGACGCGGAG
CTCGACGTCTTGATCGTCGACGACGAGTTCGCCGCGGGGGCGGCGGCGATGTCCTCAGCG
TTGCCGGACATCGAGGTCGTAACCGTGGGAGCTGAAGGGGGCCTGCCGGATTCGCAAACC
TGGGCGGAGTTCGTGGCCTCCGGGACCGGCGTCGACCCCGGACAGGGGCACGACCCGGAC
GCAGCAGTTCTGCAGCTGTACACCTCCGGGACAACCGGCCGGCCCAAGGGCGTCGTGGCC
ACGCACCGGAATCTGTACAACGAGCCCGAGGGGTTCGACGTCTACGAATTCGGTTCGGAT
GCAGTCGCACTCGACGCACTTCCTCTCTTTCACATCGCCGGTGCCGGCTGGATGAGTACG
TGCTTGTCGGCCGGGGTCCCTTTGGTGCTGCTCGGAGACCTGGCGCCGGCTCGGGTCGCT
GATGCCATCGCGACTCACCACGTCACCCACGCATTTCTGGTACCTGCCGTCATTCAGACG
CTGGTAGATCTGCCCACTCTCGACAGTTTCGATCTGACCAGCCTGGAGGTGGTCGCCTAT
GGGGCGTCGCCGATCACTCCGGCGCTCCTCGCTCATGCGATGACCGTCTTGAAGTGCAAA
TTCGTCCAGCGATACGGGATGACCGAGACAACGGGTTCGGTATCCGTCCTTCGTGCTTAC
GACCATCACGTAAGCGGACCGCGTTCGGAGTTGCTCCGCTCTGCGGGAAAACCGATGATC
GGCGTCGAGATCTCCATTCGAGACGTCACCACTGGTGAGGAATTGCCGCCCAACAATTCC
GGTGAGATCGTCGCGCGTAGTAGAAACAACACTCGCGGGTACTGGCGACGTGAACGTGAG
ACCGCCGAACTGTTCACCGACGACGGCTTCCTCCGGACGGGGGACGCCGGCCATCTGGAC
GACGAGGGGTATCTGTTCGTCACCGACCGCCTCAAGGACATGATCATCACCGGCGGTGAG
AACGTCTATCCGATCGAGGTGGAATCCGTTCTGGCCGAACACCCCTCGGTCGCCGAGGTT
GCGGTGGTCGGGGTTCCCGACAAGCGCTGGGGTGAATCCGTCACCGCGGTGGTCAAACTG
GTCGACGGTGCCGACGTGCCGAGCGTCGACGAGTTGATAGCTTTCAGCACAGCGAAGTTG
GCGTCGTACAAGAAACCTCGCCAGATCCATTTCGTGGACTCCCTACCTCGCAACGCGAGC
GGAAAACTGCTCAAGTCGAGCCTGCGGACCATGCTGAACGCGAGCGGAGAAGCATCATGA