METABLE2 Genes

PROKKA_00012 Rhodococcus

GenomeRhodococcus ctg_1:14010-15056
ProductCDS putative metallo-hydrolase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q3JRV4
Sequence
>PROKKA_00012 putative metallo-hydrolase
ATGATCGTGACCGAAGACGTCGGTGTCGCACAACGTGAGGCGTGGGCGAACAAAGTTCTT
CCACCGGTGGAACAAGTCCGGGACGGATTGTGGTCGATCCCTGTTCCCATGCCGGACAAC
CCTTTGCGCTACGTACTCGTCTACGCACTCGCGCTCGACGACGGACTTGCCCTCATCGAC
GTCGGCTGGGATCACGAACAGTCGTGGCAGGCTCTCGTCGACGGCATTACATCGATCGGA
TACCACGTTTCCGAAGTGCGCTATGCGGCAATCACCCACCTGCACCCCGATCACTTCGGC
CTGGCACCGCGTCTTCGGCAGGTCAGCGGCGCGACGCTTGCGATGCACGTGGCCGATGCG
ACGCTTCTCGGATACCACGGTCCCGAGCAGACCCGCGACGACATCACCGGCTGGAACCTG
CAGTTGTCCGAACTCGGTGCACCGGCCGAAGTGCTCGACGCGTCTCGGGTCGACCTGGTG
CGGTTCGCTGAGCACGAAACCATCGACGTTGTTCTGGGAGATGGTGATTCACTCGACCTA
CCCGGTTGGAATCTCCGGGCCCAATGGACACCGGGGCACACTCCCGGACATCTCTGCTTC
GTGGAAGAGGACAGAGGCTTGTTGTTCAGCGGCGACCACATGCTGCCGAGGATCAGCCCG
AACATCTCCACGATTCCCGGTGAACTCGAGAACCCGCTTCATCGTTATCTTCTCTCGCTC
GAGGCGACGACGACACTGGGCGAATGCGAAGTGCTTCCGGCACATGAATATCGATTCCGT
GGGATCGCCGATCGTGCACGTCAATTGATGGGGCACCACGAGGAGCGATTGGCGGAGATC
GTGGCTGCGGTGCAGGCTGAGCCCGAATCCACGGCCTGGGAACTCTCGCGCACGATCTCC
TGGTCTCGTCCGTTCGACCAGATGTCGCCGCGACTACTTCGCTTGGCAGTTCGCGAAACC
CATGCTCATCTTGTTGTTCTGGCCAAGCGGGAGATCGTGACACCGTCCGGCGGCACGCCC
GTGCGCTGGAGCCTTCGCGCGCAGTGA