METABLE2 Genes

PROKKA_00017 Rhodococcus

GenomeRhodococcus ctg_1:18539-19501
ProductCDS Nitronate monooxygenase
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF03060.9
Sequence
>PROKKA_00017 Nitronate monooxygenase
GTGACGACCTTCGCAGACCTGACGTCGCAACTGCGTGTCCCGGTTCTCGCTTCACCGATG
TTCATCATTTCGACTCCTGACCTCGTCATCGCGCAGTGCACCGCCGGGATCATCGGGTCC
TTTCCGGCACTGAATGCTCGTCCGCAGTCGGCACTTCGGGATTGGCTCAAACTGATCACC
GTGGCTCGTGAGGAACATGACCGTGAGCACCCGGAGAATCCGTCGGCGCCATTTGCCGTC
AACCTCATCGTCCACCGGTCCAACAACCGCCTGGAAGAGGACCTGGCGACCATCGCCGAG
TTCGAGGTCCCGATCGTCATCACGTCCCTCGGCGCTCGCACCGACATCAACGACGCAGTC
CACGCATACGGTGGAATCGTCCTTCACGACGTCATCGACAATCGTTTTGCACGCAAGGCG
ATCGAGAAGGGCGCCGACGGACTGATCGCGGTGGCTGCCGGGGCTGGTGGTCATGCCGGT
AGGCAGTCGCCGTTTGCCCTGATTCGTGAGATTCGTGAGTGGTTCGCCGGTCCGCTACTG
CTGTCGGGGGCTATTGCTCATGGCGATTCGGTTCTCGCTGCGCTCGCGGCCGGTGCCGAC
CTTGCTTATGTCGGTTCGGCTTTCATCGCCACCGAAGAGGCCAACGCGGATCCTGCGTAC
AAGGAGATGATCGTGGGTTCAGGGGCCTCCGACATCGTCTATTCCAACCTGTTCACCGGA
GTACACGGAAACTACCTGCGGGGCAGCATCGTTGCCGCCGGCTTGGACCCCGACAACCTG
GCCGAATCCGATCCATCCGCAATGAGTTTCGCGACCACCGACACCGATACCAAGGCGTGG
CGTGACATCTGGGGCGCCGGACAGGGCATCGGAGCGATCGACGCAGTCCTTCCGACGCAT
GCAGTAGTAGAGCGTCTCGCCGCCGAGTACGCTGCCGCTCGAGAACGTATCTGCCGACTC
TAG