METABLE2 Genes

PROKKA_00024 Rhodococcus

GenomeRhodococcus ctg_1:27405-28403
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00024 hypothetical protein
ATGAGCGAGCACTACGTCGGAGGACCGTACTTCGACGACCTCACCCACGGACAGGTATTC
GACGAAGCCCCCGCGGTCACGTTGACCAGTGGACTCGCCGCCGCCCATCAGGCGATCCTC
GGCGACCGCATGCGCCTTCCGCTCGACGCACATCTGTCGTCGAGTGTCACGGGTTCCGCT
GCACCAGTGGCAAATCCAGGTCTCGTCACCGACATCGCCATCGGCCAGTCGACCGTGGTC
ACACACCACGTCAAGGCAAACCTCTTCTACCGTGGACTGCGATTCCACCGCTTCCCGGTG
CTCGGCGACACCCTGTACACACTAACCGAGGTGGTCGGACTGAGGGAGAACTCGGCCAAG
CCGGGACGCGCTTGCACCGGTCTTGCCGCGCTGCGGATGACGTCCACCGACCAGAACGGC
AACACGGTCCTCGACTTCTACCGCTGCGCCATGCTCCCACTGAGCCCCGATCCGATCGAG
GCGCGAGTTCGCCACGCCGACGACCTCGGGGCGATCGGTCCGTCCGAACCGGATCCGTAC
CTGTCACCTGACGGCTGGGACCTCGACACGTATCGAGAGCGCGTACCCGGCAGGCACTTC
GAATCCGACCTGTTGGGTTCGGTGTTTCGCAGCAGCGGCGACGTCGTCTCCAGCGCCCCC
GAGCTTGCCCGGCTGAGCTTGAACATCGCAGCGACGCACCACGACGAGCGCGTCGGCGCC
CACGGTCGCCTCGTCTACGGCGGCCACACCATCGGGATTGCACTCGCCCAGGCAACCCGC
GCTCTGCCGAACTTGGTGACAGTGCTCGGGTGGCACTCGTGCGATCACACCGGGCCCGTG
CACGAGGGCGATACCCTCACCAGCGAACTACACGTCGAAGGCTCGTCGCCCCTCGAACAT
GGAACCGCAGTGCAGCTACGTTCACTCGTGTTCTCTCACAATGCTTCTGCAGCACACACC
CCGGTCCTCGACTGGCGTTTCACTGTGTTGATGGCATGA