METABLE2 Genes

PROKKA_00028 Rhodococcus

GenomeRhodococcus ctg_1:31485-31937
ProductCDS putative enoyl-CoA hydratase 1
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:P96807
Sequence
>PROKKA_00028 putative enoyl-CoA hydratase 1
ATGCGAATTTTCAATGGAATCGACGACGTGGAGACGGCTGTCGGTGAGCACTTGGGCTAC
AGCGCGTGGTTCCCGGTCACGCAGGATCGGATCGACAAGTTCGCCGACGCCACCGAGGAT
CACCAGTGGATTCACGTGGATCCCGAGCGGGCAGCGCAGGGTCCGTACGGCGGCACCATC
GCCCACGGCTATCTGACTCTTTCGTTGTTGCCAGTGCTCGGTGCTCAGGTGATGCGTGTC
GACGGAATCTCCATGACCGTGAACTACGGCAGCAACAAGGTGCGATTCCCCGAACCGGTC
AAGGTCGGTTCTTCGGTGCGAGCCGGTGCGGAGATTCTTTCTTTCGAGCGCTCCGCGAAG
GGCGCGACGATTGTCGTGCGGTACACGATCGAAATCGAAGGAGCGGGTAAGCCTGCGCTG
GTGGCGGATACCGTGCGCCTGTTGGTCTCCTGA