METABLE2 Genes

PROKKA_00029 Rhodococcus

GenomeRhodococcus ctg_1:31978-33174
ProductCDS putative acetyl-CoA acyltransferase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q7A7L2
Sequence
>PROKKA_00029 putative acetyl-CoA acyltransferase
GTGAAACGAGCAGCATTGGTCGCGCCGGTCAGAACCGCGGTGGGCCGGTTCGGAGGGGCA
CTTCGTGACGTGTCTGCGGAAAGTTTGGCTGCCACTGTCGTCAAGGAGACCGTGCGTCGC
AGCGGAATCGATCCGTCTCGCATCGACGACGTCGCGATGGGGCAGTCGTATGCCAATTCG
GAGGCACCGTGCATCGGCAGGTGGGCGGCGCTCGAAGCCGGGTTGCCGATTTCGGTAGCC
GGCTTCCAGACCGATCGCCGATGTGGAACGGGTCTGCAGGCCATCGTTACCGCGGCCATG
ATGGTCCAGACGGGTGCGGCCGACGTGGTTCTCGCGGGTGGCGTCGAATCGATGAGCGGG
ATCGAGCACTACACCACCGGAGCGCGGTGGGGGACCAAATCCGGTGGGCTGCAACTGTTC
GACCGCCTCGATCGTGGCCGCGAGCGCTCGCAACCCGAGTGGCGATTCGGCCGGATCAGC
GGAATGATCGAAACGGCCGAGAACGTCGCGGCGCGCTGCGGGATCACGCGGGAAGAGTCG
GACGCCTTCGCTGTCGACAGTCACCGAAAAGCAACACTGGCAAGAGATTCCGGCCGATTC
GATGCCGAAATCGTTGCCGTCGAACAGACTGATCGAAAAGGGAACGTCACACAGTTTCGT
GCTGACGAGGGGATCCGTCCGGATACCTCACTCGAAACCCTGGCACGGCTGCGTGCGGTG
ACACAGGGAGGCGTCGTGACCGCCGGTAACGCCAGCCAGCAGAACGACGCTGCGGCAGCG
ATGTTGGTGGTCGCCGAGGATCGTCTGGACGAGCTGGGGCTGGAACCCATCGGGTTCCTC
GACAGCTGGGCCGCGGCCGGTTGTGAACCGGCGCTGATGGGCCTCGGGCCGGTTGCCGCC
GTCTCGAAACTGTTTGCTCGAACAGGGGCAGGCTTTGACGACTTCGATCTGGTCGAGCTG
AACGAGGCGTTTGCGTGCCAGGTTCTCGGCGTCGTGAAGGAATGGGGCTTCGAGGACCTC
GATCGCCTGAACGTCAACGGTTCCGGCATCTCACTAGGGCACCCCGTGGGAGCGACGGGT
GCGCGTATGGCAACGACCGCGCTTCACGAACTCGGCCGACGCGGCGGCGGAAAAGCACTG
TTGACCATGTGTATCGGCGGTGGCCAGGGTATGGCGGCCGTGGTGGAGTCCGCCTGA