METABLE2 Genes

PROKKA_00030 Rhodococcus

GenomeRhodococcus ctg_1:33235-33624
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q55940
Sequence
>PROKKA_00030 hypothetical protein
TTGACGAATGCAGGTGCAGCAGAGACCAGCGGCGCGCTGAGCATCGAGGATGTTCGTCGC
GCCAGGGCTGCACTCGAGGGTCTGGACGTCACCAGTTGGTCCGGTCGCTTCGAGCTGCTC
TCCGACGCAAACCGTCTGCGTCTGCTGCTCTGCCTTCACCACGCACCGGGTATCTGCGTC
ACGGATCTGTCCGTGGCGCTGGGGATGAGCGGCACTGCGGTCTCACATGCGCTGCGCCTA
CTGCGTAGCCAGGGGTGGGTGAGCGCGACGCGCGACGGCCGATCGATGCGATACCAACTG
GCAGACGACACCGTTCACCAGCTGTTGCATTCGATCGGCGCCACACATTTTCACGACGAG
ACACCCACCCCCGGGCACACGCACAGCTGA