METABLE2 Genes

PROKKA_00031 Rhodococcus

GenomeRhodococcus ctg_1:33632-34129
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00031 hypothetical protein
GTGGAGTTCTGGCTAACGAACTGCACCGCCACCATTCACGACTGGTTCCACACAGACAGA
TTGGCCGTCCCCATGAAACTGTCCCGAACTCTCACCATGTCCGTTCTCGTTGTCGCCGCA
GTCGGCGCCGGAGCCGGCACCGCGGTCGCAGCGCCCCCGAATGCGGGCTTCGATCCGTCC
CAGCCCCTACTGACCCCGACCGCCGAGTCGAACAGCCAGGCGGCGTTGATGCTCTTCCCC
GGTAACGATCCGAAGCAAGCCGCGTTCGACACGATGGCCAACGAGGTCAATATCGGCTGG
AACAACGGCGGCTTGCAGTCGACGCTCATCGGAGCCAACCTCGGCGTCGGAATCGGCTGC
CTGTCGATCTTCCCGAACTTCATCGCCGGCTGCATCGTCGGTGGAGTCATCGGCACGGTT
GCCGGAGTCGGCGCGGGAATCACCAACGGAAACCCCAACGCTGCGCCGGCCGTCGAGAAG
TTCTTCGCGACTCCTTGA