METABLE2 Genes

PROKKA_00032 Rhodococcus

GenomeRhodococcus ctg_1:34241-34891
ProductCDS Pyridoxamine 5'-phosphate oxidase
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF01243.14
Sequence
>PROKKA_00032 Pyridoxamine 5'-phosphate oxidase
ATGTCGACCCGATACGCACACATCGCCTTCTCCCCCGCTGCGGTGGAGCGTCAGCGGTCG
ACCGGGAGTTTCACCGTCTACGGTTCGAAACTCGATCAGCCCGACGAAGGCCCGATGGAA
TTCGATTTCCGCGCTCAGGGATTCGTGAAATCCGTGGATTCCTTCTTCATGTCCACGGTG
ACGCCCGACGGGTGGCCGTACGTCCAACATCGCGGCGGCCCGCGCGGATTCCTGCATGTG
TTGGGTCCGAATCGAATCGGATTCGCCGATCTTCCCGGCAATCAGCAATTCGTGACACTC
GGCAATCTGGAAGCGAACAATCGCATCTCGCTGTTCGTCATCGACTACCCGACGCGGACG
AGATTGAAGATCTACGGGCGTGCGCAGGTGATCGAGGCGGACCAGGACCCTGCACTACTG
CAACAGCTCTTGCAAGTTCCCGGCGGCACCATGACCGCAAAAGCCCAGCGTTCCATCGTC
ATCGAGGTCGAAGCGTTCGACTGGAACTGCAGTCGAAACATCACACCTCGCTTCGACAAG
GAGCGCATGGACGAATCCCTCGCTCTGGCACGCCAACCCCTGCAAGCCGAGGTCGACCGG
CTTACAGCCGAGGTCGAGGAATTGCGCGCGCGTTTGTCGAAGAACGAATGA